Top » Catalog » SNPs » ZS4737

$18.00

ZS4737
[ZS4737]

ZS4737
hg38 Position: ChrY:19394410..19394410
Ancestral: G
Derived: A
Reference: Victar Mas (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: downstream FGC1723; Found in Big Y sample 301262
Forward Primer: ZS4737_F CGGTAAATACCTATTCTATTTTTCTTAGGTTAG
Reverse Primer: ZS4737_R AAAAATTTCTGGCCTTGCTG
Reviews

Customers who bought this product also purchased
FGC12
FGC12
YSC0000076
YSC0000076
M96
M96
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
MF113321
MF113321
FGC3718
FGC3718
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies