Top » Catalog » SNPs » BY133159

$18.00

BY133159
[BY133159]

BY133159
hg38 Position: ChrY:19309880..19309880
Ancestral: G
Derived: A
Reference: FTDNA (2018)
ISOGG Haplogroup: R1b
Comments: Below L2 > L20 > BY69713
Forward Primer: BY133159_F TGAACAGATATGCTTTCTTTCAGC
Reverse Primer: BY133159_R CCTCCCACTGATTCAAAAATG
Reviews

Customers who bought this product also purchased
BY69713
BY69713
DNA Sample Kit
DNA Sample Kit
CTS9733
CTS9733
R1b-U152 Superclade Panel
R1b-U152 Superclade Panel
L20
L20
BY149308
BY149308
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies