Top » Catalog » SNPs » BY149308

$18.00

BY149308
[BY149308]

BY149308
hg38 Position: ChrY:22211851..22211851
Ancestral: A
Derived: T
Reference: FTDNA (2018)
ISOGG Haplogroup: R1b
Comments: Below L2 > L20 > BY69713
Forward Primer: BY149308_F AAAGTTTCAATGACTGGCTATGTG
Reverse Primer: BY149308_R AGGATATATGAAAGACTGTCATCTAAAAATAGAG
Reviews

Customers who bought this product also purchased
CTS9733
CTS9733
DNA Sample Kit
DNA Sample Kit
Z33
Z33
R1b-U152 Superclade Panel
R1b-U152 Superclade Panel
L20
L20
BY133159
BY133159
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies