Top » Catalog » SNPs » FT49779

$18.00

FT49779
[FT49779]

FT49779
hg38 Position: ChrY:8256396..8256396
Ancestral: G
Derived: T
Reference: FTDNA (2019)
ISOGG Haplogroup: R1b
Comments: Below P312 > Z290 > BY22760
Forward Primer: FT49779_F TAGAATAATCTAACATGAATCTGATAGAGG
Reverse Primer: FT49779_R ACAATGTTTGCTCAGTCTGGTCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A560
$18.00
Haplogroup Info
Other products
Currencies