Top » Catalog » SNPs » FT51404

$18.00

FT51404
[FT51404]

FT51404
hg38 Position: ChrY:19983046..19983046
Ancestral: G
Derived: A
Reference: FTDNA (2019)
ISOGG Haplogroup: R1b
Comments: Below P312 > Z290 > BY22760
Forward Primer: FT51404_F TGTGTAAGGCAATGAATACAGTTTG
Reverse Primer: FT51404_R CATGTACAGCTACTGCTTTTCTGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies