Top » Catalog » SNPs » FT76862

$18.00

FT76862
[FT76862]

FT76862
hg38 Position: ChrY:15926984..15926984
Ancestral: C
Derived: A
Reference: FTDNA (2019)
ISOGG Haplogroup: R1b
Comments: Below P312 > Z290 > BY22760
Forward Primer: FT76862_F AATTCCTGGAGTGCAAGCTG
Reverse Primer: FT76862_R GTCTCGGGGTAGATGTGAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies