Top » Catalog » SNPs » FT76953

$18.00

FT76953
[FT76953]

FT76953
hg38 Position: ChrY:16646521..16646521
Ancestral: A
Derived: G
Reference: FTDNA (2019)
ISOGG Haplogroup: R1b
Comments: Below P312 > Z290 > BY22760
Forward Primer: FT76953_F AGTTTTTACCATACGTTAGCTAATGC
Reverse Primer: FT76953_R TCTTGTTTGACAGATTATGTTTGAACTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies