Top » Catalog » SNPs » FT81723

$18.00

FT81723
[FT81723]

FT81723
hg38 Position: ChrY:6902083..6902083
Ancestral: A
Derived: G
Reference: FTDNA (2019)
ISOGG Haplogroup: I1
Comments: .
Forward Primer: FT81723_F TTGCACTGGCTGCTGATTACTAG
Reverse Primer: FT81723_R GACCAGCTGCAGAAACAACC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies