Top » Catalog » SNPs » FT81919

$18.00

FT81919
[FT81919]

FT81919
hg38 Position: ChrY:12477224..12477224
Ancestral: T
Derived: A
Reference: FTDNA (2019)
ISOGG Haplogroup: I1
Comments: .
Forward Primer: FT81919_F TCCCCAGTATATGGAGTTCACTATATTTAAC
Reverse Primer: FT81919_R ATCAGATATGCATCTATCTCAGTGAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies