Top » Catalog » SNPs » FT82059

$18.00

FT82059
[FT82059]

FT82059
hg38 Position: ChrY:15611182..15611182
Ancestral: A
Derived: G
Reference: FTDNA (2019)
ISOGG Haplogroup: I1
Comments: .
Forward Primer: FT82059_F GCAAGCTAAGAACCACTGGC
Reverse Primer: FT82059_R GCTCCATGGGTGTAGGATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies