Top » Catalog » SNPs » FT82238

$18.00

FT82238
[FT82238]

FT82238
hg38 Position: ChrY:20975552..20975552
Ancestral: A
Derived: C
Reference: FTDNA (2019)
ISOGG Haplogroup: I1
Comments: .
Forward Primer: FT82238_F GGAGAAATAGAAACATACACTATTTGTGG
Reverse Primer: FT82238_R CTCTTCTTGAGATGTCATTGCTTAGTAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies