Top » Catalog » SNPs » M689

$18.00

M689
[M689]

M689
hg38 Position: ChrY:13706529..13706529
Ancestral: A
Derived: G
Reference: Underhill et al.
ISOGG Haplogroup: R
Comments: Derived in HUGO
Forward Primer: M689_F GTTTTTGATTGTGCTGATTTGAATC
Reverse Primer: M689_R TTTTTAGTTAAGGCTGTATTTCTTATGGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies