Top » Catalog » SNPs » Y142769

$18.00

Y142769
[Y142769]

Y142769
hg38 Position: ChrY:22305026..22305026
Ancestral: C
Derived: T
Reference: YFull (2018)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: Y142769_F TTAAAACTGAATAAACGTTTCAAGTCTCC
Reverse Primer: Y142769_R CTCCCAAAATGGCTCTCCG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies