Top » Catalog » SNPs » A25010

$18.00

A25010
[A25010]

A25010
hg38 Position: ChrY:20818968..20818968
Ancestral:
Derived:
Reference: Joshua Kelley (2019)
ISOGG Haplogroup: R1b
Comments: Below A426
Forward Primer: A25010_F GATTTCTGCATTTCCAACTGAAG
Reverse Primer: A25010_R ACTTGATGAGGCATTCTGTTCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies