Top » Catalog » SNPs » BY153125

$18.00

BY153125
[BY153125]

BY153125
hg38 Position: ChrY:9292396..9292396
Ancestral: G
Derived: A
Reference: FTDNA (2018)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: BY153125_F CTTCCTAAGCAGAGGAAAATGG
Reverse Primer: BY153125_R GGGAACCAATTCTTGCACAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies