Top » Catalog » SNPs » BY153836

$18.00

BY153836
[BY153836]

BY153836
hg38 Position: ChrY:13149475..13149475
Ancestral: T
Derived: A
Reference: FTDNA (2018)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: BY153836_F TCAAGGCTCTCTTCAAACTGG
Reverse Primer: BY153836_R GCAACAAAAACATAAACACTTGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies