Top » Catalog » SNPs » BY154723

$18.00

BY154723
[BY154723]

BY154723
hg38 Position: ChrY:16713543..16713543
Ancestral: T
Derived: A
Reference: FTDNA (2018)
ISOGG Haplogroup: R1b
Comments: Below FGC13326 > Y128031
Forward Primer: BY154723_F GGAGGAGCCATTGCATTTG
Reverse Primer: BY154723_R TTCTTAGTTTCATTGTATACATATCTTTAAAAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies