Top » Catalog » SNPs » BY34642

$18.00

BY34642
[BY34642]

BY34642
hg38 Position: ChrY:14855668..14855668
Ancestral: C
Derived: T
Reference: FTDNA (2018)
ISOGG Haplogroup: R1b
Comments:
Forward Primer: BY34642_F ATGTGCCATGTAAGTATATATGTGTATTTTATAGC
Reverse Primer: BY34642_R ATACAAGGATGCATGTATTGCG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies