Top » Catalog » SNPs » FT76237

$18.00

FT76237
[FT76237]

FT76237
hg38 Position: ChrY:12179551..12179551
Ancestral: G
Derived: C
Reference: FTDNA (2019)
ISOGG Haplogroup: R1b
Comments: Below U106 > DF96 > BY171114
Forward Primer: FT76237_F GCAAGCTCCACCTCCTGC
Reverse Primer: FT76237_R ATTACAGATGCTCACCACCAAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies