Top » Catalog » SNPs » FT77301

$18.00

FT77301
[FT77301]

FT77301
hg38 Position: ChrY:19899950..19899950
Ancestral: C
Derived: T
Reference: FTDNA (2019)
ISOGG Haplogroup: R1b
Comments: Below U106 > DF96 > BY171114
Forward Primer: FT77301_F TAGGGCCTTGGGGAATTTAC
Reverse Primer: FT77301_R TTTGAGGCCATTTTCTAGATCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies