Top » Catalog » SNPs » BY152858

$18.00

BY152858
[BY152858]

BY152858
hg38 Position: ChrY:8401049..8401049
Ancestral: T
Derived: C
Reference: FTDNA (2018)
ISOGG Haplogroup: I2
Comments: Below L621 > A22312 > BY152858
Forward Primer: BY152858_F GACCACCTGGTAAATTATCTTTAGTAAAGTTG
Reverse Primer: BY152858_R GCCTTACCAATTGTGAAGCAAG
Reviews

Customers who bought this product also purchased
BY153567
BY153567
BY154460
BY154460
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies