Top » Catalog » SNPs » Z209

$18.00

Z209
[Z209]

Z209
hg38 Position: ChrY:13396260..13396260
Ancestral: T
Derived: G
Reference: http://dna-forums.org/
ISOGG Haplogroup: R1b1a1a2a1a2a1a1
Comments: Below DF27 > Z296
Forward Primer: Z209_F AGCTGGGATTTCAATCAAGTG
Reverse Primer: Z209_R AAAGCCAATTTTAAACAAAACCTG
Reviews

Customers who bought this product also purchased
Z295
Z295
CTS4065
CTS4065
Y17144
Y17144
DF17
DF17
FGC13557
FGC13557
Z216
Z216
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A16670
$18.00
Haplogroup Info
Other products
Currencies