Top » Catalog » SNPs » Z216

$18.00

Z216
[Z216]

Z216
hg38 Position: ChrY:15909470..15909470
Ancestral: C
Derived: T
Reference: http://dna-forums.org/
ISOGG Haplogroup: R1b1a2a1a2a1a1a1
Comments: Below DF27 > Z295
Forward Primer: Z216_F CCCTCAGGCACTCAAACC
Reverse Primer: Z216_R ATCACCATTCACCTGCTTCC
Reviews

Customers who bought this product also purchased
FGC28375
FGC28375
DF19
DF19
L51
L51
YSEQ-Alpha
YSEQ-Alpha
A8344
A8344
L238
L238
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies