Top » Catalog » SNPs » Z296

$18.00

Z296
[Z296]

Z296
hg38 Position: ChrY:9175422..9175422
Ancestral: C
Derived: A
Reference: http://dna-forums.org/
ISOGG Haplogroup: R1b (not listed)
Comments: Below DF27 > Z196
Forward Primer: Z296_F CAAAAGAAGGAGGAAATACGGC
Reverse Primer: Z296_R CTCCCTGGTTCACGCCAC
Reviews

Customers who bought this product also purchased
BY27831
BY27831
Y152744
Y152744
A15900
A15900
Y139205
Y139205
Y30819
Y30819
FT44481
FT44481
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies