Top » Catalog » SNPs » Z296

$18.00

Z296
[Z296]

Z296
hg38 Position: ChrY:9175422..9175422
Ancestral: C
Derived: A
Reference: http://dna-forums.org/
ISOGG Haplogroup: R1b (not listed)
Comments: Below DF27 > Z196
Forward Primer: Z296_F CAAAAGAAGGAGGAAATACGGC
Reverse Primer: Z296_R CTCCCTGGTTCACGCCAC
Reviews

Customers who bought this product also purchased
Z209
Z209
CTS4188
CTS4188
FGC39110
FGC39110
S8825
S8825
Y31346
Y31346
Z2563
Z2563
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies