Top » Catalog » SNPs » Z296

$18.00

Z296
[Z296]

Z296
hg38 Position: ChrY:9175422..9175422
Ancestral: C
Derived: A
Reference: http://dna-forums.org/
ISOGG Haplogroup: R1b (not listed)
Comments: Below DF27 > Z196
Forward Primer: Z296_F CAAAAGAAGGAGGAAATACGGC
Reverse Primer: Z296_R CTCCCTGGTTCACGCCAC
Reviews

Customers who bought this product also purchased
BY21077
BY21077
BY3332
BY3332
FGC46562
FGC46562
BY27831
BY27831
A15900
A15900
FGC39546
FGC39546
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies