Top » Catalog » SNPs » Z296

$18.00

Z296
[Z296]

Z296
hg38 Position: ChrY:9175422..9175422
Ancestral: C
Derived: A
Reference: http://dna-forums.org/
ISOGG Haplogroup: R1b (not listed)
Comments: Below DF27 > Z196
Forward Primer: Z296_F CAAAAGAAGGAGGAAATACGGC
Reverse Primer: Z296_R CTCCCTGGTTCACGCCAC
Reviews

Customers who bought this product also purchased
Z2103
Z2103
Y36421
Y36421
M267
M267
M70
M70
Y31384
Y31384
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies