Top » Catalog » SNPs » FGC19955

$18.00

FGC19955
[FGC19955]

FGC19955
hg38 Position: ChrY:15246815..15246815
Ancestral: C
Derived: T
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FGC19955_F TCATTTCCCATTTGTGAATATTCC
Reverse Primer: FGC19955_R GTAATATCAGCTCATTTCAGCATACATC
Reviews

Customers who bought this product also purchased
Wish a SNP
Wish a SNP
FGC19958
FGC19958
FGC19956
FGC19956
FT81898
FT81898
FGC19952
FGC19952
FT81871
FT81871
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies