Top » Catalog » SNPs » FGC19959

$18.00

FGC19959
[FGC19959]

FGC19959
hg38 Position: ChrY:18651724..18651724
Ancestral: G
Derived: T
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FGC19959_F TTGTTGTTCTTCCAAAGAGACTCG
Reverse Primer: FGC19959_R TAGTTAGCCTTAAAAAAAAATCCTAATC
Reviews

Customers who bought this product also purchased
FGC19951
FGC19951
FGC19962
FGC19962
FGC19950
FGC19950
FGC19958
FGC19958
Wish a SNP
Wish a SNP
FGC19956
FGC19956
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies