Top » Catalog » SNPs » FGC19959

$18.00

FGC19959
[FGC19959]

FGC19959
hg38 Position: ChrY:18651724..18651724
Ancestral: G
Derived: T
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FGC19959_F TTGTTGTTCTTCCAAAGAGACTCG
Reverse Primer: FGC19959_R TAGTTAGCCTTAAAAAAAAATCCTAATC
Reviews

Customers who bought this product also purchased
FGC19956
FGC19956
FGC19955
FGC19955
FT81898
FT81898
FGC19952
FGC19952
FT81871
FT81871
FGC19951
FGC19951
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies