Top » Catalog » SNPs » FT81871

$18.00

FT81871
[FT81871]

FT81871
hg38 Position: ChrY:11894113..11894113
Ancestral: A
Derived: T
Reference: Jerry Weaver (2019)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FT81871_F GAGGTAAAAGGGGAGGATGG
Reverse Primer: FT81871_R CTACCAACTCCACATTACCTTCC
Reviews

Customers who bought this product also purchased
FGC19962
FGC19962
FGC19951
FGC19951
FGC19959
FGC19959
FGC19950
FGC19950
FGC19958
FGC19958
Wish a SNP
Wish a SNP
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies