Top » Catalog » SNPs » FT81871

$18.00

FT81871
[FT81871]

FT81871
hg38 Position: ChrY:11894113..11894113
Ancestral: A
Derived: T
Reference: Jerry Weaver (2019)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FT81871_F GAGGTAAAAGGGGAGGATGG
Reverse Primer: FT81871_R CTACCAACTCCACATTACCTTCC
Reviews

Customers who bought this product also purchased
FGC19956
FGC19956
FGC19955
FGC19955
FT81898
FT81898
FGC19952
FGC19952
FGC19962
FGC19962
FGC19951
FGC19951
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies