Top » Catalog » SNPs » BY5524

$18.00

BY5524
[BY5524]

BY5524
hg38 Position: ChrY:8695253..8695253
Ancestral: G
Derived: A
Reference: FTDNA (2016)
ISOGG Haplogroup: E
Comments: Below BY34331
Forward Primer: BY5524_F AGGCTTTGTGGTTCTGTGGTAG
Reverse Primer: BY5524_R CACAGGGCTTCTTGAATTTATGTC
Reviews

Customers who bought this product also purchased
BY5523
BY5523
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies