Top » Catalog » SNPs » ZS8277

$18.00

ZS8277
[ZS8277]

ZS8277
hg38 Position: ChrY:21152685..21152685
Ancestral: T
Derived: C
Reference: Victar Mas (2015)
ISOGG Haplogroup: J1
Comments: Downstream ZS4753
Forward Primer: ZS8277_F CTATTCCATTTTCCTGTGCCC
Reverse Primer: ZS8277_R TTTTCCTAGAGCTTACCAGTCAAC
Reviews

Customers who bought this product also purchased
FT169592
FT169592
Y164628
Y164628
ZS11060
ZS11060
BY195383
BY195383
FGC4316
FGC4316
FGC38809
FGC38809
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies