Top » Catalog » SNPs » ZS8277

$18.00

ZS8277
[ZS8277]

ZS8277
hg38 Position: ChrY:21152685..21152685
Ancestral: T
Derived: C
Reference: Victar Mas (2015)
ISOGG Haplogroup: J1
Comments: Downstream ZS4753
Forward Primer: ZS8277_F CTATTCCATTTTCCTGTGCCC
Reverse Primer: ZS8277_R TTTTCCTAGAGCTTACCAGTCAAC
Reviews

Customers who bought this product also purchased
M96
M96
FGC7
FGC7
M267
M267
FGC1713
FGC1713
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
FGC1696
FGC1696
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies