Top » Catalog » SNPs » BY33530

$18.00

BY33530
[BY33530]

BY33530
hg38 Position: ChrY:7489591..7489591
Ancestral: T
Derived: C
Reference: FTDNA (2018)
ISOGG Haplogroup: R1b
Comments: Below L2 > BY33528
Forward Primer: BY33530_F GGAGTTTTCCCTCAGCCTG
Reverse Primer: BY33530_R ATAATCCAACAGAAAGCAGCTGG
Reviews

Customers who bought this product also purchased
Wish a SNP
Wish a SNP
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies