Top » Catalog » SNPs » A25171

$18.00

A25171
[A25171]

A25171
hg38 Position: ChrY:12653246..12653246
Ancestral: C
Derived: T
Reference: YSEQ (2019)
ISOGG Haplogroup: R1a
Comments: Below L664 > YP942
Forward Primer: A25171_F CCTGGGTTCAAGTGATTCTCTG
Reverse Primer: A25171_R GCAATACTCCCCAAATTGATCTAC
Reviews

Customers who bought this product also purchased
A25170
A25170
A25172
A25172
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies