Top » Catalog » SNPs » Y176313

$18.00

Y176313
[Y176313]

Y176313
hg38 Position: ChrY:17189795..17189795
Ancestral: G
Derived: A
Reference: YFull (2019)
ISOGG Haplogroup: R1b
Comments: Below .DF27/S250 > ZZ12 > Z2573 > Z29624
Forward Primer: Y176313_F CCCTTGCAAATCACACTGG
Reverse Primer: Y176313_R CTGTCACCCGAATCACTTCAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies