Top » Catalog » SNPs » FT3066

$18.00

FT3066
[FT3066]

FT3066
hg38 Position: ChrY:15449885..15449885
Ancestral: A
Derived: G
Reference: FTDNA (2019)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FT3066_F AGTGCAGGAAGTAACTGCAGAC
Reverse Primer: FT3066_R ATAGCCAGGCATGGTGACC
Reviews

Customers who bought this product also purchased
FT3092
FT3092
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies