Top » Catalog » SNPs » FT83587

$18.00

FT83587
[FT83587]

FT83587
hg38 Position: ChrY:12021533..12021533
Ancestral: C
Derived: A
Reference: FTDNA (2019)
ISOGG Haplogroup: J2
Comments: .
Forward Primer: FT83587_F TACCTCTTTGTTCTAATTACCCATTCAG
Reverse Primer: FT83587_R GGTAGTGCATGCCTGTAATCC
Reviews

Customers who bought this product also purchased
FT84003
FT84003
FT83442
FT83442
FT83405
FT83405
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies