Top » Catalog » SNPs » Y36095

$18.00

Y36095
[Y36095]

Y36095
hg38 Position: ChrY:2984814..2984814
Ancestral: G
Derived: A
Reference: YFull (2017)
ISOGG Haplogroup: I1
Comments: Below DF29 > S7642 > Y15543
Forward Primer: Y36095_F TGGCAGGTGCTTGTAACTCC
Reverse Primer: Y36095_R TGGGCAGCAGAGCAAGAC
Reviews

Customers who bought this product also purchased
A17798
A17798
A17801
A17801
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies