Top » Catalog » SNPs » FGC91001

$18.00

FGC91001
[FGC91001]

FGC91001
hg38 Position: ChrY:9234281..9234281
Ancestral: T
Derived: C
Reference: Full Genomes Corp. (2019)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC91001_F AAGTTTCCTCAGATGAAAAAAAAATTAG
Reverse Primer: FGC91001_R AACTTGCAGTAGCAGTTAGTATACTTCATCC
Reviews

Customers who bought this product also purchased
FGC67352
FGC67352
Y176977
Y176977
FGC91004
FGC91004
FGC91003
FGC91003
FGC91002
FGC91002
FGC91000
FGC91000
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies