Top » Catalog » SNPs » FGC91002

$18.00

FGC91002
[FGC91002]

FGC91002
hg38 Position: ChrY:13288727..13288727
Ancestral: T
Derived: C
Reference: Full Genomes Corp. (2019)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC91002_F GTAAGGCAAAAACTGTATAATAGTACCG
Reverse Primer: FGC91002_R AGGTACATGTGCCAGTTTTGTTATC
Reviews

Customers who bought this product also purchased
FGC91003
FGC91003
FGC91001
FGC91001
FGC91000
FGC91000
FGC67352
FGC67352
Y176977
Y176977
FGC91004
FGC91004
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies