Top » Catalog » SNPs » FGC17371

$18.00

FGC17371
[FGC17371]

FGC17371
hg38 Position: ChrY:6830800..6830800
Ancestral: T
Derived: G
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: E
Comments: .
Forward Primer: FGC17371_F ACTTCCATTAGTATTTTTACCTGTAATGG
Reverse Primer: FGC17371_R GAGGCAGGAAAATGGTGTG
Reviews

Customers who bought this product also purchased
Y129964
Y129964
F15443
F15443
Y128502
Y128502
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies