Top » Catalog » SNPs » FGC48131

$18.00

FGC48131
[FGC48131]

FGC48131
hg38 Position: ChrY:19727957..19727957
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC48131_F AAAAGAAGTATGAGCAGAAAAAGG
Reverse Primer: FGC48131_R GCAAGTTTTCTTGATGTGTGG
Reviews

Customers who bought this product also purchased
Y164628
Y164628
FT44221
FT44221
FGC10095
FGC10095
M96
M96
M267
M267
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies