Top » Catalog » SNPs » FT43969

$18.00

FT43969
[FT43969]

FT43969
hg38 Position: ChrY:20407649..20407649
Ancestral: C
Derived: T
Reference: FTDNA (2019)
ISOGG Haplogroup: J
Comments: .
Forward Primer: FT43969_F AAAGACAACCCAAATGAAGAGG
Reverse Primer: FT43969_R CCTGTTTTCTTTCCAGAAAACCTAG
Reviews

Customers who bought this product also purchased
FGC2
FGC2
FGC4243
FGC4243
FT157054
FT157054
FGC1696
FGC1696
ZS11060
ZS11060
FGC4316
FGC4316
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies