Top » Catalog » SNPs » FT43969

$18.00

FT43969
[FT43969]

FT43969
hg38 Position: ChrY:20407649..20407649
Ancestral: C
Derived: T
Reference: FTDNA (2019)
ISOGG Haplogroup: J
Comments: .
Forward Primer: FT43969_F AAAGACAACCCAAATGAAGAGG
Reverse Primer: FT43969_R CCTGTTTTCTTTCCAGAAAACCTAG
Reviews

Customers who bought this product also purchased
FGC4314
FGC4314
Y183541
Y183541
FGC1713
FGC1713
FT44221
FT44221
M96
M96
Y170491
Y170491
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies