Top » Catalog » SNPs » FT43969

$18.00

FT43969
[FT43969]

FT43969
hg38 Position: ChrY:20407649..20407649
Ancestral: C
Derived: T
Reference: FTDNA (2019)
ISOGG Haplogroup: J
Comments: .
Forward Primer: FT43969_F AAAGACAACCCAAATGAAGAGG
Reverse Primer: FT43969_R CCTGTTTTCTTTCCAGAAAACCTAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies