Top » Catalog » SNPs » FT44221

$18.00

FT44221
[FT44221]

FT44221
hg38 Position: ChrY:21093786..21093786
Ancestral: A
Derived: T
Reference: FTDNA (2019)
ISOGG Haplogroup: J1
Comments: Below FGC38802 > FT43969
Forward Primer: FT44221_F GGACCAGACCTTTTCGGG
Reverse Primer: FT44221_R TGTCAATTCCTGCATCAGATCTC
Reviews

Customers who bought this product also purchased
M96
M96
FT43969
FT43969
FGC1713
FGC1713
ZS4756
ZS4756
M267
M267
Y183541
Y183541
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies