Top » Catalog » SNPs » FT44221

$18.00

FT44221
[FT44221]

FT44221
hg38 Position: ChrY:21093786..21093786
Ancestral: A
Derived: T
Reference: FTDNA (2019)
ISOGG Haplogroup: J1
Comments: Below FGC38802 > FT43969
Forward Primer: FT44221_F GGACCAGACCTTTTCGGG
Reverse Primer: FT44221_R TGTCAATTCCTGCATCAGATCTC
Reviews

Customers who bought this product also purchased
ZS4756
ZS4756
M267
M267
Y183541
Y183541
FGC1696
FGC1696
FGC10095
FGC10095
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies