Top » Catalog » SNPs » FT44221

$18.00

FT44221
[FT44221]

FT44221
hg38 Position: ChrY:21093786..21093786
Ancestral: A
Derived: T
Reference: FTDNA (2019)
ISOGG Haplogroup: J1
Comments: Below FGC38802 > FT43969
Forward Primer: FT44221_F GGACCAGACCTTTTCGGG
Reverse Primer: FT44221_R TGTCAATTCCTGCATCAGATCTC
Reviews

Customers who bought this product also purchased
FGC1707
FGC1707
ZS4753
ZS4753
Y170491
Y170491
FGC5
FGC5
FGC4314
FGC4314
FGC48131
FGC48131
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies