Top » Catalog » SNPs » FT80854

$18.00

FT80854
[FT80854]

FT80854
hg38 Position: ChrY:13633566..13633566
Ancestral: T
Derived: C
Reference: FTDNA (2019)
ISOGG Haplogroup: I1
Comments: .
Forward Primer: FT80854_F CCAAGCAGAAACTCCCAAG
Reverse Primer: FT80854_R CTAACAATCAGTCCTCTCCAGGAC
Reviews

Customers who bought this product also purchased
FT81015
FT81015
A13252
A13252
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies